purple 6 (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
97
Structured Review
New England Biolabs
purple 6
Purple 6, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/purple+6/Gel+Loading+Dye%2C+Purple+(6X)%2C+no+SDS/pm42050335-379-17-21
Average 97 stars, based on 479 article reviews
Purple 6, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/purple+6/Gel+Loading+Dye%2C+Purple+(6X)%2C+no+SDS/pm42050335-379-17-21
Average 97 stars, based on 479 article reviews
purple 6 - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Staining:Article Title: Peptide-enabled ribonucleoprotein delivery for CRISPR engineering (PERC) in primary human immune cells and hematopoietic stem cells. Article Snippet: .. • MiSeq reagent kit v2 (300 cycles) (Illumina, cat. no. MS-103-1002) • Agarose ultrapure (Fisher Scientific, cat. no. 16500-100) • SYBR Safe DNA gel stain (Fisher Scientific, cat. no. S33102) • Gel loading dye, Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Flow Cytometry:Article Title: Peptide-enabled ribonucleoprotein delivery for CRISPR engineering (PERC) in primary human immune cells and hematopoietic stem cells. Article Snippet: .. • MiSeq reagent kit v2 (300 cycles) (Illumina, cat. no. MS-103-1002) • Agarose ultrapure (Fisher Scientific, cat. no. 16500-100) • SYBR Safe DNA gel stain (Fisher Scientific, cat. no. S33102) • Gel loading dye, Virus:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Transfection:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Plasmid Preparation:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Purification:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Polymerase Chain Reaction:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Gel Extraction:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Reverse Transcription:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Random Hexamer:Article Title: Visualizing infection by single positive-sense RNA viruses using virus infection real-time imaging (VIRIM). Article Snippet: To understand viral infection and virus–host interactions, real-time, single-cell assays to track viral infection progression are essential.. Many conventional assays sample large numbers of cells for single measurements, averaging out the cell-to-cell heterogeneity that is intrinsic to viral infection.. Moreover, conventional assays often require cell fixation or lysis, limiting analysis to a single timepoint and masking the temporal and spatial dynamics of infection. Incubation:Article Title: Evidence for improved DNA repair in the long-lived bowhead whale Article Snippet: .. The reaction mixtures were incubated for 1 h at 30 °C, followed by the addition of 2 μl of Gel Loading Dye, Article Title: Evidence for improved DNA repair in long-lived bowhead whale. Article Snippet: Denis Firsanov, Max Zacher, Xiao Tian, Todd L. Sformo, Yang Zhao, Gregory Tombline, J. Yuyang Lu, Zhizhong Zheng, Luigi Perelli, Enrico Gurreri, Li Zhang, Jing Guo, Anatoly Korotkov, Valentin Volobaev, Seyed Ali Biashad, Zhihui Zhang, Johanna Heid, Alexander Y. Maslov, Shixiang Sun, Zhuoer Wu, Jonathan Gigas, Eric C. Hillpot, John C. Martinez, Minseon Lee, Alyssa Williams, Abbey Gilman, Nicholas Hamilton, Ekaterina Strelkova, Ena Haseljic, Avnee Patel, Maggie E. Straight, Nalani Miller, Julia Ablaeva, Lok Ming Tam, Chloé Couderc, Michael R. Hoopmann, Robert L. Moritz, Shingo Fujii, Amandine Pelletier, Dan J. Hayman, Hongrui Liu, Yuxuan Cai, Anthony K. L. Leung, Zhengdong Zhang, C. Bradley Nelson, Lisa M. Abegglen, Joshua D. Schiffman, Vadim N. Gladyshev, Carlo C. Maley, Mauro Modesti, Giannicola Genovese, Mirre J. P. Simons, Jan Vijg5 ✉, Andrei Seluanov1,23 ✉ & Vera Gorbunova1,23 ✉ other:Article Title: Targeted C-to-T Base Editing in the Arabidopsis Plastid Genome. Article Snippet: See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense TAL-F2, 5′- GGAGGCAGTGCATGCATGGC -3′ pK7WG2_fsFw, 5′- TTCTCTTAGGTTTACCCGCC -3′ tHSP_fsRv, 5′- CCATAGTCCATACCATAGCAC -3′ Ole_fsRv, 5′- CTAAGTAGGGTGCCGGGGAT -3′ 1333N_checkRv, 5′- GGCAGGCAATTGAGGAGCTG -3′ 1333C_checkRv, 5′- GGCGTAATTCGGATACGGAG -3′ 1397N_checkRv, 5′- CAGGCAATTGTGGAGCTGAG -3′ 1397N_TtoC_Rv, 5′- GGGCTGATTGACCTTCAACAT -3′ 1397C_checkRv, 5′- CGTTTCTCCTGTAGCTCCTC -3′ E1 and E3 vectors (Table 1) TE, pH 8.0 (Nippon Gene, cat. no. 314-90021) Tango Buffer (10×) (Thermo Fisher Scientific, cat. no. BY5) 10 mM dithiothreitol (see recipe) BsmBI (Thermo Fisher Scientific, cat. no. ER0452) LB kanamycin plate (see recipe) Sterile distilled water (e.g., Nippon Gene, cat. no. 312-90103) KOD One® PCR Master Mix -Blue- (dye-containing 2× PCR master mix; TOYOBO, cat. no. KMM-201) 250 bp DNA Ladder (Dye Plus) (TaKaRa, cat. no. 3424A) 1% (w/v) agarose gel (see recipe) 1× TBE buffer (see recipe) LB kanamycin medium (see recipe) LR ClonaseTM II Plus (with proteinase K included; Thermo Fisher Scientific, cat. no. 12538200) E. coli HST08 Premium Competent Cells (TaKaRa, cat. no. 9128) 1 kb DNA Ladder (Dye Plus) (TaKaRa, cat. no. 3426A) Gel Loading Dye, Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. |